Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
circABCB10/hsa_circ_0008717 | |||
Gene | ABCB10 | Organism | Human |
Genome Locus | chr1:229665945-229678118:- | Build | hg19 |
Disease | Breast Cancer | ICD-10 | Malignant neoplasm of breast (C50) |
DBLink | Link to database | PMID | 28744405 |
Experimental Method | |||
Sample Type | Tissues and Cell lines | Comparison | 36 samples (cancer and adjacent noncancerous tissue) and Human breast cancer cell lines (MCF-7, MDA-MB-231, MDA-MB-468, MDA-MB-453) and normal human breast epithelial cells (MCF-10A) |
Method for Estimation | Quantitative PCR and Microarrays | PCR Details | |
Primers (Experimented) | Forward CTAAGGAGTCACAGGAAGACATC ReverseGTAGAATCTCTCAGACTCAAGGTTG | Statistics | Fold Change : Upregulated pvalue : p<0.05 |
Citation | |||
Liang, HF, Zhang, XZ, Liu, BG, Jia, GT, Li, WL (2017). Circular RNA circ-ABCB10 promotes breast cancer proliferation and progression through sponging miR-1271. Am J Cancer Res, 7, 7:1566-1576. |